Sequence retrieval

Genome: Treponema brennaborense DSM 12168
Start position: 926103
End position: 926129
Length: 27

DNA sequence
>NC_015500, from 926103 to 926129 (27 bp); Treponema brennaborense DSM 12168 CATGCCGCCCATGTCGCCCATACCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 926098-927738	Sequence	Trebr_0753 - 60 kDa chaperonin (Protein is coded in complementary strand; from 927738 to 926098)