Sequence retrieval

Genome: Treponema brennaborense DSM 12168
Start position: 664844
End position: 664867
Length: 24

DNA sequence
>NC_015500, from 664844 to 664867 (24 bp); Treponema brennaborense DSM 12168 TTTCAGGTTCAGTATCAGTTCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 663897-665417	Sequence	Trebr_0538 - monosaccharide-transporting ATPase (Protein is coded in complementary strand; from 665417 to 663897)