Sequence retrieval

Genome: Treponema brennaborense DSM 12168
Start position: 643605
End position: 643658
Length: 54

DNA sequence
>NC_015500, from 643605 to 643658 (54 bp); Treponema brennaborense DSM 12168 TCTTCAAGCTCTTCGACGTCTTCGAGTTCTTCAACGTCTTCAATCTCTTCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 642375-645107	Sequence	Trebr_0519 - hypothetical protein (Protein is coded in complementary strand; from 645107 to 642375)