Sequence retrieval

Genome: Treponema brennaborense DSM 12168
Start position: 607292
End position: 607345
Length: 54

DNA sequence
>NC_015500, from 607292 to 607345 (54 bp); Treponema brennaborense DSM 12168 CGCTATTTCCGGTGAGAGTGCTATTTCCGGCGAAAGTGCTATTTCCGGCGAAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 606019-607533	Sequence	Trebr_0489 - amidohydrolase (Protein is coded in complementary strand; from 607533 to 606019)