Sequence retrieval

Genome: Treponema brennaborense DSM 12168
Start position: 404673
End position: 404696
Length: 24

DNA sequence
>NC_015500, from 404673 to 404696 (24 bp); Treponema brennaborense DSM 12168 GCCGCCGCCGCTTCCGCCGCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 404628-405590	Sequence	Trebr_0351 - Orotidine 5'-phosphate decarboxylase (Protein is coded in complementary strand; from 405590 to 404628)