Sequence retrieval

Genome: Treponema brennaborense DSM 12168
Start position: 2808063
End position: 2808107
Length: 45

DNA sequence
>NC_015500, from 2808063 to 2808107 (45 bp); Treponema brennaborense DSM 12168 CCGCCGAGTTCGACACAGCCGAATTCGATACCCCCGACTTCGACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2807604-2809370	Sequence	Trebr_2381 - peptidoglycan-binding lysin domain-containing protein