Sequence retrieval

Genome: Treponema brennaborense DSM 12168
Start position: 2737040
End position: 2737063
Length: 24

DNA sequence
>NC_015500, from 2737040 to 2737063 (24 bp); Treponema brennaborense DSM 12168 GCGTCGGCGGCGGCATCGGCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2736731-2737591	Sequence	Trebr_2324 - oxidoreductase FAD/NAD(P)-binding domain-containing protein