Sequence retrieval

Genome: Treponema brennaborense DSM 12168
Start position: 271525
End position: 271548
Length: 24

DNA sequence
>NC_015500, from 271525 to 271548 (24 bp); Treponema brennaborense DSM 12168 TCGGTTTCGGTGACGGTTTCCGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 270574-271896	Sequence	Trebr_0243 - hypothetical protein (Protein is coded in complementary strand; from 271896 to 270574)