Sequence retrieval

Genome: Treponema brennaborense DSM 12168
Start position: 264936
End position: 264995
Length: 60

DNA sequence
>NC_015500, from 264936 to 264995 (60 bp); Treponema brennaborense DSM 12168 GATTTTTCCGCAGATGATTTTTCGGCGGAGGCCTTTTCGGCAGATGATTTTTCGGCGGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 264045-265715	Sequence	Trebr_0238 - phosphoenolpyruvate-protein phosphotransferase (Protein is coded in complementary strand; from 265715 to 264045)