Sequence retrieval

Genome: Treponema brennaborense DSM 12168
Start position: 2609310
End position: 2609363
Length: 54

DNA sequence
>NC_015500, from 2609310 to 2609363 (54 bp); Treponema brennaborense DSM 12168 CGCCGCATTCCGGCAAAGTGCCGCATTCCGGCAAAACGCCATTTTCCGGCAAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2608412-2609410	Sequence	Trebr_2199 - GTP-binding protein Era-like-protein (Protein is coded in complementary strand; from 2609410 to 2608412)