Sequence retrieval

Genome: Treponema brennaborense DSM 12168
Start position: 2568190
End position: 2568219
Length: 30

DNA sequence
>NC_015500, from 2568190 to 2568219 (30 bp); Treponema brennaborense DSM 12168 CGCAAAACGCCTCAAAACACCTCAAAACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2568202-2568459	Sequence	Trebr_2172 - hypothetical protein (Protein is coded in complementary strand; from 2568459 to 2568202)