Sequence retrieval

Genome: Treponema brennaborense DSM 12168
Start position: 2527386
End position: 2527409
Length: 24

DNA sequence
>NC_015500, from 2527386 to 2527409 (24 bp); Treponema brennaborense DSM 12168 CGACGGCGACCGCGACGCCGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2524790-2529022	Sequence	Trebr_2138 - phosphoribosylformylglycinamidine synthase (Protein is coded in complementary strand; from 2529022 to 2524790)