Sequence retrieval

Genome: Treponema brennaborense DSM 12168
Start position: 2445348
End position: 2445371
Length: 24

DNA sequence
>NC_015500, from 2445348 to 2445371 (24 bp); Treponema brennaborense DSM 12168 CCGCAGCCGCAGCCGCAGCCGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2443347-2445428	Sequence	Trebr_2069 - heavy metal translocating P-type ATPase (Protein is coded in complementary strand; from 2445428 to 2443347)