Sequence retrieval

Genome: Treponema brennaborense DSM 12168
Start position: 2433360
End position: 2433383
Length: 24

DNA sequence
>NC_015500, from 2433360 to 2433383 (24 bp); Treponema brennaborense DSM 12168 CAGAATCAGGATTAGAATCAGAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2433320-2433544	Sequence	Trebr_2060 - hypothetical protein (Protein is coded in complementary strand; from 2433544 to 2433320)