Sequence retrieval

Genome: Treponema brennaborense DSM 12168
Start position: 2365857
End position: 2365881
Length: 25

DNA sequence
>NC_015500, from 2365857 to 2365881 (25 bp); Treponema brennaborense DSM 12168 AAAAAAAGAAAAAATAAAAATAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2364922-2365902	Sequence	Trebr_1997 - hypothetical protein (Protein is coded in complementary strand; from 2365902 to 2364922)