Sequence retrieval

Genome: Treponema brennaborense DSM 12168
Start position: 2134150
End position: 2134173
Length: 24

DNA sequence
>NC_015500, from 2134150 to 2134173 (24 bp); Treponema brennaborense DSM 12168 TAGTCTTAGTCTTAGTCTTAGTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2133681-2134865	Sequence	Trebr_1812 - 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein (Protein is coded in complementary strand; from 2134865 to 2133681)