Sequence retrieval

Genome: Treponema brennaborense DSM 12168
Start position: 2075867
End position: 2075911
Length: 45

DNA sequence
>NC_015500, from 2075867 to 2075911 (45 bp); Treponema brennaborense DSM 12168 CCGCTTCGAGTGAAACCTCTTCAAGTGAAACCGCTCCGAGCGAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2075210-2076406	Sequence	Trebr_1759 - sporulation domain-containing protein