Sequence retrieval

Genome: Treponema brennaborense DSM 12168
Start position: 2048626
End position: 2048649
Length: 24

DNA sequence
>NC_015500, from 2048626 to 2048649 (24 bp); Treponema brennaborense DSM 12168 TTTTTTTTTATTTTTTTCCTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2048634-2049017	Sequence	Trebr_1737 - hypothetical protein (Protein is coded in complementary strand; from 2049017 to 2048634)