Sequence retrieval

Genome: Treponema brennaborense DSM 12168
Start position: 2032134
End position: 2032169
Length: 36

DNA sequence
>NC_015500, from 2032134 to 2032169 (36 bp); Treponema brennaborense DSM 12168 GCCGCGTAACCGTCCGCATAACCGGCGGCGTAACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2031987-2033105	Sequence	Trebr_1729 - hypothetical protein (Protein is coded in complementary strand; from 2033105 to 2031987)