Sequence retrieval

Genome: Treponema brennaborense DSM 12168
Start position: 2013349
End position: 2013402
Length: 54

DNA sequence
>NC_015500, from 2013349 to 2013402 (54 bp); Treponema brennaborense DSM 12168 CCGCACTAGCCGTACAAACCGCGCTAGCCGCATAAATCACGCTAGCCGTACAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2010767-2013358	Sequence	Trebr_1709 - diguanylate cyclase/phosphodiesterase