Sequence retrieval

Genome: Treponema brennaborense DSM 12168
Start position: 1909207
End position: 1909230
Length: 24

DNA sequence
>NC_015500, from 1909207 to 1909230 (24 bp); Treponema brennaborense DSM 12168 CTGCGGCTGCAGCTGCGGCGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1908732-1910966	Sequence	Trebr_1615 - hypothetical protein (Protein is coded in complementary strand; from 1910966 to 1908732)