Sequence retrieval

Genome: Treponema brennaborense DSM 12168
Start position: 1613985
End position: 1614029
Length: 45

DNA sequence
>NC_015500, from 1613985 to 1614029 (45 bp); Treponema brennaborense DSM 12168 GCGTCGTCAGCCGAAGCGTCGTCAGCCGAAGCGTCGTCAGCCGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1612425-1614224	Sequence	Trebr_1362 - RpoD subfamily RNA polymerase sigma-70 subunit (Protein is coded in complementary strand; from 1614224 to 1612425)