Sequence retrieval

Genome: Treponema brennaborense DSM 12168
Start position: 1605771
End position: 1605797
Length: 27

DNA sequence
>NC_015500, from 1605771 to 1605797 (27 bp); Treponema brennaborense DSM 12168 TTTATTCCTTTTATTCCTTTTATTCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1605791-1607671	Sequence	Trebr_1356 - penicillin-binding protein 2 (Protein is coded in complementary strand; from 1607671 to 1605791)