Sequence retrieval

Genome: Treponema brennaborense DSM 12168
Start position: 1437448
End position: 1437471
Length: 24

DNA sequence
>NC_015500, from 1437448 to 1437471 (24 bp); Treponema brennaborense DSM 12168 CCGCTTCCGCTTCCGCTTCCGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1435671-1437698	Sequence	Trebr_1207 - hypothetical protein (Protein is coded in complementary strand; from 1437698 to 1435671)