Sequence retrieval

Genome: Treponema brennaborense DSM 12168
Start position: 1070195
End position: 1070218
Length: 24

DNA sequence
>NC_015500, from 1070195 to 1070218 (24 bp); Treponema brennaborense DSM 12168 GCGGCGATGCGGCGATGCGGCGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1069648-1071093	Sequence	Trebr_0874 - hypothetical protein (Protein is coded in complementary strand; from 1071093 to 1069648)