Sequence retrieval

Genome: Pyrococcus sp. NA2
Start position: 945773
End position: 945805
Length: 33

DNA sequence
>NC_015474, from 945773 to 945805 (33 bp); Pyrococcus sp. NA2 ATGATACCTTTATGAGCCCTTTATGATACCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 945794-947137	Sequence	PNA2_1027 - hypothetical protein (Protein is coded in complementary strand; from 947137 to 945794)