Sequence retrieval

Genome: Pyrococcus sp. NA2
Start position: 1360571
End position: 1360600
Length: 30

DNA sequence
>NC_015474, from 1360571 to 1360600 (30 bp); Pyrococcus sp. NA2 CTCTCTTAGGCTTTCGTAGGCTCTCTTTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1360356-1361345	Sequence	PNA2_1483 - anion transporting atpase (Protein is coded in complementary strand; from 1361345 to 1360356)