Sequence retrieval

Genome: Gallibacterium anatis UMN179
Start position: 659891
End position: 659950
Length: 60

DNA sequence
>NC_015460, from 659891 to 659950 (60 bp); Gallibacterium anatis UMN179 TCACGACCACGACCACGACCACGACCACGACCACGACCACGACCACGACCACGACCACGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 659536-660498	Sequence	UMN179_00620 - high-affinity zinc transporter periplasmic protein