Sequence retrieval

Genome: Gallibacterium anatis UMN179
Start position: 886142
End position: 886195
Length: 54

DNA sequence
>NC_015460, from 886142 to 886195 (54 bp); Gallibacterium anatis UMN179 CATCATACCGCCCATTCCACCCATACCGCCCATTCCACCCATACCGCCCATTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 886140-887801	Sequence	UMN179_00828 - chaperonin GroEL (Protein is coded in complementary strand; from 887801 to 886140)