Sequence retrieval

Genome: Gallibacterium anatis UMN179
Start position: 1681837
End position: 1681881
Length: 45

DNA sequence
>NC_015460, from 1681837 to 1681881 (45 bp); Gallibacterium anatis UMN179 ACCAATCAGCGGGGTACCAATCAGCGGGGTACCAATCAGCGGGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1681547-1685827	Sequence	UMN179_01558 - Eco57I restriction endonuclease (Protein is coded in complementary strand; from 1685827 to 1681547)