Sequence retrieval

Genome: Gallibacterium anatis UMN179
Start position: 634677
End position: 634712
Length: 36

DNA sequence
>NC_015460, from 634677 to 634712 (36 bp); Gallibacterium anatis UMN179 ATATCGCTGAAAATATCACCGAAAATATCGCCGAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 633855-634976	Sequence	UMN179_00597 - chaperone protein DnaJ (Protein is coded in complementary strand; from 634976 to 633855)