Sequence retrieval

Genome: Gallibacterium anatis UMN179
Start position: 251156
End position: 251191
Length: 36

DNA sequence
>NC_015460, from 251156 to 251191 (36 bp); Gallibacterium anatis UMN179 TGATTTTCTGTTTGATTTTCTGTTTGATTTTCTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 250547-251203	Sequence	UMN179_00248 - putative solute/DNA competence effector protein (Protein is coded in complementary strand; from 251203 to 250547)