Sequence retrieval

Genome: Gallibacterium anatis UMN179
Start position: 2508703
End position: 2508732
Length: 30

DNA sequence
>NC_015460, from 2508703 to 2508732 (30 bp); Gallibacterium anatis UMN179 TTTTTATTCGTTTTTATGCTTTTTTCATCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2508717-2510510	Sequence	UMN179_02333 - ATP-dependent protease Lon (Protein is coded in complementary strand; from 2510510 to 2508717)