Sequence retrieval

Genome: Gallibacterium anatis UMN179
Start position: 1462625
End position: 1462651
Length: 27

DNA sequence
>NC_015460, from 1462625 to 1462651 (27 bp); Gallibacterium anatis UMN179 TTTGTTCAATTTGTTCAATTTGTTCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1461946-1462674	Sequence	UMN179_01349 - lipoate-protein ligase B (Protein is coded in complementary strand; from 1462674 to 1461946)