Sequence retrieval

Genome: Gallibacterium anatis UMN179
Start position: 737184
End position: 737207
Length: 24

DNA sequence
>NC_015460, from 737184 to 737207 (24 bp); Gallibacterium anatis UMN179 AAATAACAATAAAAGTAAAAATAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 736346-737485	Sequence	UMN179_00688 - hypothetical protein (Protein is coded in complementary strand; from 737485 to 736346)