Sequence retrieval

Genome: Gallibacterium anatis UMN179
Start position: 325661
End position: 325684
Length: 24

DNA sequence
>NC_015460, from 325661 to 325684 (24 bp); Gallibacterium anatis UMN179 TTGCCTTTTAGCCTTTTCGCCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 323722-325662	Sequence	UMN179_00316 - putative helicase (Protein is coded in complementary strand; from 325662 to 323722)