Sequence retrieval

Genome: Gallibacterium anatis UMN179
Start position: 312583
End position: 312606
Length: 24

DNA sequence
>NC_015460, from 312583 to 312606 (24 bp); Gallibacterium anatis UMN179 AATATTAACATTGATATTAATATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 312254-313366	Sequence	UMN179_00306 - lipopolysaccharide biosynthesis protein WzzE (Protein is coded in complementary strand; from 313366 to 312254)