Sequence retrieval

Genome: Gallibacterium anatis UMN179
Start position: 2273723
End position: 2273746
Length: 24

DNA sequence
>NC_015460, from 2273723 to 2273746 (24 bp); Gallibacterium anatis UMN179 AAATAAAAAAATGAAAAAATAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2273691-2275313	Sequence	UMN179_02118 - thiamine transporter membrane protein (Protein is coded in complementary strand; from 2275313 to 2273691)