Sequence retrieval

Genome: Gallibacterium anatis UMN179
Start position: 2054095
End position: 2054118
Length: 24

DNA sequence
>NC_015460, from 2054095 to 2054118 (24 bp); Gallibacterium anatis UMN179 TGTTTTTATTTTTGATTTTGTTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2054022-2054363	Sequence	UMN179_01906 - hypothetical protein (Protein is coded in complementary strand; from 2054363 to 2054022)