Sequence retrieval

Genome: Gallibacterium anatis UMN179
Start position: 102671
End position: 102694
Length: 24

DNA sequence
>NC_015460, from 102671 to 102694 (24 bp); Gallibacterium anatis UMN179 TATTTTTATTTCTATATTTAATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 100536-102671	Sequence	UMN179_00086 - 23S rRNA methylteansferase (Protein is coded in complementary strand; from 102671 to 100536)