Sequence retrieval

Genome: Burkholderia gladioli BSR3
Start position: 947647
End position: 947670
Length: 24

DNA sequence
>NC_015381, from 947647 to 947670 (24 bp); Burkholderia gladioli BSR3 TTCCTCTTCGTCTTCTTCTTCCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 947639-948151	Sequence	bgla_1g08460 - 6,7-dimethyl-8-ribityllumazine synthase (Protein is coded in complementary strand; from 948151 to 947639)