Sequence retrieval

Genome: Burkholderia gladioli BSR3
Start position: 920953
End position: 920979
Length: 27

DNA sequence
>NC_015381, from 920953 to 920979 (27 bp); Burkholderia gladioli BSR3 GGCACGCCGGGCAAGCCGAGCACGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 920929-921270	Sequence	bgla_1g08210 - PadR family transcriptional regulator (Protein is coded in complementary strand; from 921270 to 920929)