Sequence retrieval

Genome: Burkholderia gladioli BSR3
Start position: 627325
End position: 627349
Length: 25

DNA sequence
>NC_015381, from 627325 to 627349 (25 bp); Burkholderia gladioli BSR3 GCGCGCCGCGTCGCGGCGCAGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 626786-627787	Sequence	bgla_1g05640 - Thiamine monophosphate kinase (Protein is coded in complementary strand; from 627787 to 626786)