Sequence retrieval

Genome: Burkholderia gladioli BSR3
Start position: 533429
End position: 533452
Length: 24

DNA sequence
>NC_015381, from 533429 to 533452 (24 bp); Burkholderia gladioli BSR3 AGCGCGAGCCCGAGCGCCCGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 533135-533926	Sequence	bgla_1g04830 - phenylacetate degradation enoyl-CoA hydratase PaaB (Protein is coded in complementary strand; from 533926 to 533135)