Sequence retrieval

Genome: Burkholderia gladioli BSR3
Start position: 4294884
End position: 4294907
Length: 24

DNA sequence
>NC_015381, from 4294884 to 4294907 (24 bp); Burkholderia gladioli BSR3 GCCGGCGCGGGCGCCTGCGCCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4294857-4296554	Sequence	bgla_1g37750 - Oxidoreductase, GMC family protein (Protein is coded in complementary strand; from 4296554 to 4294857)