Sequence retrieval

Genome: Burkholderia gladioli BSR3
Start position: 4285096
End position: 4285119
Length: 24

DNA sequence
>NC_015381, from 4285096 to 4285119 (24 bp); Burkholderia gladioli BSR3 GCCTGCGCGTGCGCCTGGCCCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4285003-4286454	Sequence	bgla_1g37650 - hypothetical protein (Protein is coded in complementary strand; from 4286454 to 4285003)