Sequence retrieval

Genome: Burkholderia gladioli BSR3
Start position: 4090051
End position: 4090077
Length: 27

DNA sequence
>NC_015381, from 4090051 to 4090077 (27 bp); Burkholderia gladioli BSR3 GCCCGTGCCGCCGGTGCCACCCGTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4090028-4090906	Sequence	bgla_1g36030 - Enoyl-CoA hydratase (Protein is coded in complementary strand; from 4090906 to 4090028)