Sequence retrieval

Genome: Burkholderia gladioli BSR3
Start position: 3958149
End position: 3958172
Length: 24

DNA sequence
>NC_015381, from 3958149 to 3958172 (24 bp); Burkholderia gladioli BSR3 TCGTCGTCGTCCGCGTCGTCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3957891-3959891	Sequence	bgla_1g34810 - Potassium efflux system protein (Protein is coded in complementary strand; from 3959891 to 3957891)