Sequence retrieval

Genome: Burkholderia gladioli BSR3
Start position: 385467
End position: 385496
Length: 30

DNA sequence
>NC_015381, from 385467 to 385496 (30 bp); Burkholderia gladioli BSR3 GCGGCGGCGGGGGCGGAGGAGGCGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 383129-385579	Sequence	bgla_1g03430 - Penicillin-binding protein, 1A family protein (Protein is coded in complementary strand; from 385579 to 383129)