Sequence retrieval

Genome: Burkholderia gladioli BSR3
Start position: 3703094
End position: 3703117
Length: 24

DNA sequence
>NC_015381, from 3703094 to 3703117 (24 bp); Burkholderia gladioli BSR3 GCGGAAGTGGAAGCGAAATCGGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3702023-3703126	Sequence	bgla_1g32620 - UDP-N-acetylenolpyruvoylglucosamine reductase (Protein is coded in complementary strand; from 3703126 to 3702023)